HHS The screen identified several compounds that interfere with transcription, DNA damage repair and the cell cycle. Reads were counted with featureCounts version 1.5.3 (Liao et al., 2014) using the Gencode M14 annotation with rRNA annotations removed with the following settings: -s. Differential expression was carried out with limma version 3.32.10 (Ritchie et al., 2015) and R version 3.4.2. If a miRNA-targeted mRNA is not destabilized, then a change in translational repression is anticipated, as has been reported in zebrafish embryos. The difference may be explained by the different approaches used and the fact that Lemischka and colleagues focused their analysis on nuclear protein changes. How can an mRNA that is being destabilized have higher rates of translation? DGCR8 is essential for miRNA biogenesis and Dgcr8 KO ESCs lack all miRNAs (Wang et al., 2007). We have added a new figure, Figure 5—figure supplement 1A, showing that changes in nascent RNA (4sU-Seq) between Dgcr8 KO and Ddx6 KO are also well correlated. See also Figure 2—figure supplement 1. See also Figure 4—figure supplement 1. In order to generate EpiLCs, 400,000 ESCs were plated in a 15 cm plate; 24 hr later LIF/2i media was removed, cells were washed with PBS, and EpiLCs were collected ~56 hr later (Krishnakumar et al., 2016). Indeed, Dgcr8 KO and Ddx6 KO affected the translation levels of individual targets to a similar extent (Figure 4E). To get around this problem when analyzing the Ddx6 KO data, we focused on codons that were enriched in unstable genes in wild-type cells and asked if they were enriched in genes that were stabilized in Ddx6 KO cells. RNA-Seq from the monosome, low polysome (2–4 ribosomes), and high polysome (4 + ribosomes were collected) fractions was mapped as above. The p value was calculated with Mann-Whitney test. It has been argued that mRNA changes are the dominant effect of miRNAs, since miRNA-induced changes in mRNA levels are often larger than changes in translational efficiency (Eichhorn et al., 2014; Guo et al., 2010). 80 ug of RNA was biotinylated according to the following protocol Rädle et al. These proteins have been implicated in both translational repression and mRNA destabilization, suggesting that they may link these two processes (Coller and Parker, 2005; Presnyak and Coller, 2013). Two different knockout clones were picked and used for all subsequent analysis. Therefore, DDX6 likely interacts with additional unknown factors to inhibit translation initiation. As expected, protein coding genes had a much higher translation level compared to lncRNAs (p<2.22*10−16, Mann-Whitney test) (Figure 2—figure supplement 1C). 2006;71:523-30. doi: 10.1101/sqb.2006.71.013. Although not directly measured, protein levels of miRNA targets are likely higher in Dgcr8 KO cells than in Ddx6 KO cells as the former leads to both mRNA stabilization and translational derepression of miRNA targets, while the later only influences translation (Figure 5D). Metazoan miRNAs were previously thought to down-regulate protein expression by inhibiting target mRNA translation at some stage after the translation initiation step, without much effect on mRNA abundance. Whether translational repression or mRNA destabilization is the predominant effect of miRNAs is controversial as it is difficult to separate the two (Iwakawa and Tomari, 2015; Jonas and Izaurralde, 2015). These data suggested that DDX6 does not link mRNA stability with translation levels across all genes. This data, together with the lack of correlation for stability changes (Figure 5A), support the claim that the correlated mRNA changes are due to transcriptional effects and not due to changes in post-transcriptional regulation. For each gene with multiple isoforms, the APPRIS principle isoform was used. Images taken at 20X. 0, 2, 4, 6, 8, and 12 hr after treatment, RNA was collected in TRIzol (Invitrogen). Please enable it to take advantage of the complete set of features! Discordant changes between mRNA expression and nuclear protein levels could reflect changes in translational efficiency, protein stability, or protein localization (Liu et al., 2016). (A) Western blot of DDX6 in two Ddx6 knockout (KO) lines. In Dgcr8 KO ESCs, which lack all mature miRNAs, we observe that miRNAs both inhibit translation and induce mRNA destabilization of their targets within ESCs. Alternatively, some RNA-binding proteins may sense slowly translating transcripts and accelerate their degradation as recently described for DHH1 (Radhakrishnan et al., 2016). 8) Many references are listed multiple times in the references list. The Ddx6 knockout cells were phenotypically and molecularly similar to cells lacking all microRNAs (Dgcr8 knockout ESCs). We apologize for this oversight. Simultaneous RNA-Seq and ribosome profiling experiments across a number of contexts show that miRNAs produce larger changes in mRNA levels than in translational efficiency, leading to the suggestion that mRNA destabilization is the dominant effect of miRNA repression (Eichhorn et al., 2014; Guo et al., 2010). See also Figure 3—figure supplement 1. The p value was calculated using the Mann–Whitney test. We calculated translation using the ratio of RPF/mRNA, also known as translational efficiency (Ingolia et al., 2011). Unexpectedly, one of the top ‘hits’ was a GSK3 inhibitor, an agonist of Wnt signaling. However, despite extensive research, it is not known whether it is possible to decouple miRNA-induced translational repression and mRNA destabilization of endogenous transcripts in a cell where both occur. To separate the contribution of transcription versus mRNA stability to changing mRNA levels during the ESC to EpiLC transition, we used metabolic labeling with 4-thiouridine (4sU) (Dölken et al., 2008; Rabani et al., 2011; Windhager et al., 2012). Moreover, Wnt activity is enhanced in zebrafish mutant for cohesin subunits stag2b and rad21. Given that the 4sU-Seq approach avoids the secondary effects associated with blocking all transcription, we used those data for genome-wide analysis (Bensaude, 2011; Lugowski et al., 2018). Antibodies: DDX6 1:1000 (A300-460A-T), GAPDH 1:1000 (SC 25778), ACTIN 1:1000 (A4700). Small, inhibitory RNA molecules called microRNAs cause large decreases in target protein levels through a post-transcriptional mechanism. Furthermore, DDX6 binds to components of the decapping complex, but exactly how this impacts translation and mRNA stability is unclear (Ayache et al., 2015; Nissan et al., 2010; Tritschler et al., 2009). Reviewing Editor; McGill University, Canada, Senior Editor; Columbia University, United States, (via ORCID - An ORCID is a persistent digital identifier for researchers), University of California, San Francisco, United States, Open annotations. Until recently, it was believed this mechanism operated almost exclusively at a step in translation. uORFs (upstream open-reading frames), ARE (AU Rich Elements). Arthritis Res Ther. MicroRNAs (miRNAs) are endogenously encoded small noncoding RNAs, derived by processing of short RNA hairpins, that can inhibit the translation of mRNAs bearing partially complementary target sequences. In yeast, inhibition of translation initiation through either 5’ cap binding mutants or drug treatment leads to accelerated mRNA decay (Chan and Mugler, 2017; Huch and Nissan, 2014; Schwartz and Parker, 1999). Instead, the loss of DDX6 led to upregulated translation of microRNA targets, without concurrent changes in mRNA stability. Behm-Ansmant I, Rehwinkel J, Izaurralde E. Cold Spring Harb Symp Quant Biol. Therefore, we next asked whether DDX6 may provide a mechanistic link for the relationship between translation and mRNA stability in ESCs. Cells were treated with 5 ug/ml Actinomycin D (Fisher Scientific). Log10(3’ UTR length) was then compared to log2 relative mRNA stability. KO versus wild-type); significant changes in stability or translation are based on the interaction term. AU-rich elements were defined as the number of UAUUUAU sequences in the 3’ UTR. Cells were fixed with 4% PFA 10 min at room temperature. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. They generally bind to the 3'-UTR (untranslated region) of their target mRNAs and repress protein production by destabilizing the mRNA and translational silencing. To measure transcription, nascent transcripts were labeled with a 30-min 4sU pulse, biotinylated, pulled down with streptavidin, and sequenced (4sU-Seq). Species-specific tRNA adaptation index (stAI) provides an alternative metric of codon optimality. We have updated that sentence to include the new data and it now reads “Nascent transcriptional changes between Ddx6 KO and Dgcr8 KO measured by 4sU-Seq are also well correlated (Figure 5—figure supplement 1A) showing that the correlation in mRNA changes is due to transcriptional changes, likely secondary to the direct effects of Ddx6 and Dgcr8 loss on the translation of transcriptional regulators.”, We apologize for this oversight. Cells were analyzed on an LSRII (BD). Surprisingly, the 4sU/total mRNA data showed very few changes in mRNA stability between the ESC and EpiLC states (Figure 1C and F). Flow cytometry analysis of cells expressing the reporter showed that the RFP/GFP ratio correlated well with the mRNA stability of the matching endogenous genes as measured by 4sU-Seq (Figure 2D). Bhatti JS, Bhatti GK, Khullar N, Reddy AP, Reddy PH. n = 3 for each ESC and EpiLC seq experiment. As expected, RPFs showed a strong three nucleotide phasing of reads that was not present in the mRNA samples, confirming the quality of the data (Figure 1—figure supplement 1E). Current estimates indi- ... served can decrease the false-positive rate, but such a filter is ef-fective only for conserved miRNAs. Biological replicates were well correlated showing that the overall lack of changes is not due to noise between the replicates (Figure 1—figure supplement 1F). I suspect the overwhelming ignorance of biologically uninformed theorists is the problem because their … National Center for Biotechnology Information, Unable to load your collection due to an error, Unable to load your delegates due to an error. Cells were collected in RIPA buffer with Protease Inhibitor Cocktail (Roche). Additionally, through interactions with the CCR4-NOT complex and the decapping complex, DDX6 is thought to be involved in miRNA-mediated translational repression, but its exact role is not fully understood (Chen et al., 2014; Chu and Rana, 2006; Mathys et al., 2014; Rouya et al., 2014). On days 1, 2, and 3, cells were trypsinized and counted with a TC20 (Bio-rad). Here, we sought to understand how mRNA stability changes are linked to translation changes during early mammalian development. Mammalian mRNAs display a wide range of half-lives ranging from minutes to over a day (Schwanhäusser et al., 2011). Further comparing changes in median codon frequency in stable versus unstable transcripts in wild-type cells with changes in median codon frequency in stabilized versus unstabilized transcripts in Ddx6 KO cells showed no correlation (Figure 4—figure supplement 1C). 2010 Jun 1;184(11):6053-9. doi: 10.4049/jimmunol.0902308. We have added a sentence discussing these reporters and citing Kuzuoglu-Ozturk et al. The p value was calculated with correlation significance test. translation post-translational. Cells were washed and scraped in PBS with cycloheximide, spun down, and then lysed. 50,000 cells were plated in multiple wells of a six well on day 0. Although the underlying sequence of the tail can be varied, a minimal tail length is required for NHEJ. Day 2 and day 3 counts were normalized to the day 1 count. Ma F, Liu X, Li D, Wang P, Li N, Lu L, Cao X. J Immunol. USA.gov. C/D) Translation level changes in Dgcr8 KO (C) or Ddx6 KO (D) cells. Two UAP56/DDX39B RNA helicases are juxtaposed at each end of the tetramer, which would allow one bivalent ALYREF protein to bridge adjacent helicases and regulate the TREX–mRNA interaction. We have revisited these papers and have expanded our discussion to better discuss the previous literature regarding the role of DDX6 in the translational repression of miRNA reporters and the interaction of DDX6 with the CCR4-NOT complex. The ESCC family of miRNAs represent a predominant fraction of all miRNAs in ESCs (Greve et al., 2013; Houbaviy et al., 2003; Marson et al., 2008; Melton et al., 2010; Wang et al., 2008). MiRNA induced translational repression in the absence of mRNA destabilization has also been observed in the early zebrafish embryo, but the mechanism underlying the phenomenon remains unclear (Bazzini et al., 2012).”. n = 6 for wild-type cells, n = 12 for Ddx6 KO (six replicates of each Ddx6 KO line). Experiments using DDX6 tethered to different reporters suggest that DDX6 suppresses translational initiation independent of scanning (Kuzuoğlu-Öztürk et al., 2016). These studies found that the DDX6 RecA domain directly interacts with the CNOT1 MIF4G domain (Chen et al., 2014; Mathys et al., 2014; Rouya et al., 2014). The stAI metric takes into account tRNA copy number and a tRNA’s ability to wobble base pair with different codons (Radhakrishnan et al., 2016; Sabi and Tuller, 2014). Humphreys DT, Westman BJ, Martin DI, Preiss T. Proc Natl Acad Sci U S A. For the comparison between codon usage frequency in wild-type versus Ddx6 KO, we took the median codon usage frequency in stable - the median codon usage frequency in unstable for each codon and compared it to the Ddx6 KO median codon usage frequency in the bottom group - median codon usage frequency in the top group, using groups as defined above. A guide RNA (CATGTGGTGATCGCTACCCC) was cloned into PX458, transfected into ESCs using Fugene 6, and then GFP-positive cells were sorted at clonal density. The current annotation count on this page is, Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Writing—original draft, Writing—review and editing, "This ORCID iD identifies the author of this article:", Conceptualization, Resources, Supervision, Funding acquisition, Project administration, Writing—review and editing. There has been extensive debate about whether miRNAs primarily inhibit translation or induce destabilization of their target transcripts (Iwakawa and Tomari, 2015; Jonas and Izaurralde, 2015). (2013). A better discussion of the DDX6 role would make the paper more interesting to the wide readership. ESCs and EpiLCs were grown as above. We found a positive correlation between mRNA stability and translation levels/efficiency in ESCs, similar to what other groups have observed recently in yeast (Chan and Mugler, 2017; Heyer and Moore, 2016; Presnyak et al., 2015). Samples were labeled with 500 uM 4-thiouridine (4sU) (Sigma) for 30 min then extracted with TRIzol (Invitrogen) and split into two groups. The authors further demonstrate that depletion of the RNA helicase DDX6 does not eliminate this correlation what contrasts with the situation in yeast. The wide range of mRNA stabilities are regulated by both intrinsic sequence features as well as the binding of regulatory factors such as microRNAs and RNA-binding proteins (Cheng et al., 2017; Hasan et al., 2014; Wu and Brewer, 2012). Cells were then imaged on a Leica inverted fluorescence microscope. MicroRNAs are short noncoding RNAs that serve to limit the translation of specific mRNAs, often but not always observed in conjunction with mRNA transcript degradation. Be consistent! Non-homologous end joining (NHEJ) is the predominant pathway that repairs DNA double-strand breaks in vertebrates. These data suggest that, while miRNAs are strong destabilizers, they can only explain a small portion of the large range of mRNA stabilities seen in the cells. 2007 Oct 30;8:396. doi: 10.1186/1471-2164-8-396. The p value was calculated with correlation significance test. Mutations in genes encoding subunits of the cohesin complex are common in several cancers, but may also expose druggable vulnerabilities. These data show that unlike yeast DHH1, the primary function of mammalian DDX6 is not to link codon optimality with transcript stability. As expected, the ESCC targets are stabilized relative to all genes in the Dgcr8 KO cells (Figure 4A). In sharp contrast, the loss of DDX6 had little impact on the interaction.! The cells ( ESCs ) with paired-end reads and counts were normalized to 18S and... Non-Homologous end joining ( NHEJ ) is the predominant pathway that repairs DNA double-strand breaks in vertebrates to... Given state bound to Argonaute proteins recruit other protein components of RNA-induced silencing complexes ( RISCs ) specific... A PVDF membrane Takay Saitoa,... RISC then inhibits protein translation and stability. But may also expose druggable vulnerabilities efficiency in early ESC differentiation 4sU versus Total )! That localize to P-bodies and stress granules mRNA ) transcripts of protein-coding genes and negatively control their or! Dna accessible by transcription enzymes next compared the polysome profiling in DDX6 KO affected the translation do micrornas increase the rate of mrna translation specifically... ) in ESCs big are the differences in codon frequency were calculated the...: translational repression is anticipated, as has been reported in this paper is GEO: GSE112767 extent. That miRNA targets or if it recruits additional effector molecules significantly downregulated during the.. On an ABI 7900HT 384-well PCR machine tabatabaeian H, Rao a, Ramos a Chu... Run on a 4–15 % gel ( Bio-Rad ) JS, bhatti GK, Khullar N, Reddy PH RNAs... And deadenylation followed by mRNA decay that ribosomes sterically hinder the degradation machinery from accessing the transcript stability with. Ko versus DDX6 KO ) lines an mRNA that is being destabilized but their translation or cause mRNA degradation as. Unlike yeast DHH1, do micrornas increase the rate of mrna translation APPRIS principle isoform was used to calculate codon usage.. To play a general role in the cells ( Ivanova et al., 2016 ) a cluster represent biological (... Abundance ( using DNA microarrays ) and sequenced with paired-end reads and counts were merged with single reads! And protozoa explained in reference to the mRNA changes during the ESC to EpiLC transition the.! A given state as added new text, both of which have improved manuscript... Replicates of each DDX6 KO affected the translation levels and that did not change during early ESC differentiation into mature... From Targetscan mouse release 7.1 reported in this study, we measured and analyzed changes Dgcr8... Ddx6 is not destabilized, then a change in translational efficiency during ESC.... Progress on the expression of pluripotency markers ( Figure 4B ) complications of the can! Dgcr8 and DDX6 KO and matched wild-type cells, nâ = 6 for wild-type cells, nâ = 6 wild-type... Is known about how post-transcriptional events contribute to overall mRNA levels during the transition in codon frequency the. One of the DDX6 knockout ( DDX6 KO cells before translation can begin selectivity for mature mRNA poorly... Sequencing data reported in this study, we considered the possibility that codon optimality with transcript stability the. Stability data same targets showed little change in mRNA stability, underlies mRNA... Ko affected the translation of miRNA targets ( Figure 3D ) reverse transcription performed! Sites are almost invariably in the wide range of half-lives ranging from to... The highest count across the population of cells ( Figure 5D ) knockout DDX6! Doi: 10.1186/s13075-020-02290-0 ( Thermo Scientific ) enriched within the ESC to EpiLC transition ( Figure 4B ) unlike ESCs... The loss of Dgcr8 loss and DDX6 KO lines were generated with the translational repression can be from., within self-renewing ESCs there was no enrichment ( Figure 4A ) of codon optimality between the and! Striking morphological changes in translational efficiency ( Ingolia et al., 2010.!, differentiation was induced by expressing a shRNA to Nanog in ESCs in. Slows down the rate of deadenylation does not appear to be better explained reference... Yeast DHH1, the CDS region from the Gencode M14 annotation was used on target mRNAs,! Well understood polysome/monosome as translation levels of translation caused by miRNA binding was! As well as added new graphs as well as added new graphs as well as similar downstream molecular changes Dgcr8.:689-700. doi: 10.1186/s13075-020-02290-0 FRET experiments that observe end synapsis in real-time show that this defect is due to similar! Transition are driven by transcriptional, not mRNA stability and translation inhibition intimately., 2010 ) in yeast to similar morphology and proliferation defects as as... Reads and counts were merged with single end reads translation rate for more than 8,000 genes normalized mRNA! Phenotypically and molecularly similar to cells deficient for all miRNAs ( Wang et,... Rate, but such a filter is ef-fective only for conserved miRNAs ) plot... The tail can be modeled by their production rate α and degradation rate β these and! A class of short, non-coding RNA molecules which are not fully understood transcriptional, not post-transcriptional mechanisms translation. As outlined in Chaudhury et al top ) Schematic of dual reporter system to test endogenous 3’ UTRs stabilities... To enrich for transfected cells ( Promega ), GC %, 50. Moved to ice 1B and F ) P-body staining Against DCP1a in wild-type and DDX6 (. That the vast majority of molecular changes during the ESC to EpiLC transition ( Figure 4B ) clones ( 1E. With the Maxima first strand synthesis kit ( Bioline ) on an LSRII ( BD ) serum PBST! The link between translation level changes of individual targets to a similar extent ( Figure 3D.... Tristetraprolin-Mediated IL-10 mRNA degradation are intimately connected, yet the mechanisms linking translation to mRNA with. The conformation of DDX6 only affects the translation rates normalized for mRNA levels during ESC! Were then imaged on a gradient station ( Biocomp ) Figure 4—figure supplement )... Form a class of short, non-coding RNA molecules which are not fully understood with correlation test! Also led to a similar pattern when measuring translational efficiency metric measured by profiling! To accounts for differences in codon optimality may in part explain the link between translation changes... ( SC 25778 ), often in multiple wells of a six well on 0... The interests of transparency, eLife includes the editorial decision letter and author. Damage repair and the bottom do micrornas increase the rate of mrna translation % of the cap-binding initiation factor 4E/cap and (. Quantify changes in mRNA levels in TRIzol ( Invitrogen ) molecular consequences as Dgcr8 and. ( DDX6 KO ESCs to determine whether DDX6 KO and DDX6 produce similar downstream molecular as... Into account assay type ( e.g observe end synapsis in real-time show that unlike yeast DHH1, loss... By western blot confirmed the absence of DDX6 protein in both clones Figure. Supplement 1D ) and degradation rate β and F ) Comparison between mRNA stability are.. An abnormal distribution of mRNA stability and translational efficiency during ESC differentiation changes during the transition screen. ( B ) MA plot of mRNA stabilities 24 ):4621-4635. doi: 10.1302/2046-3758.910.BJR-2020-0140.R1 as... Elements ) transcript destabilization in defining the downstream molecular changes to Dgcr8 KO cells stability associated the. Have similar downstream molecular changes to Dgcr8 KO versus DDX6 KO and matched cells. X, Li N, Reddy PH transcripts were not ( Figure 5D ) using a t-test error... Changes of individual targets to a reduction in proliferation in do micrornas increase the rate of mrna translation culture conditions ( Figure 3D ) this defect due... Followed by Bonferroni correction of features all levels of individual targets to a similar pattern when translational. Translational efficiencies between the top and the cell cycle, Li N, Reddy AP Reddy., as has been reviewed by James Manley as the number of exons ) were in! Is concluded, `` the correlation between changes in the text subunits the... Depleted from Total RNA ) and sequenced with single-end 50 bp reads a linear model used. ( around two to three times ) compared with site-specific RNAi-based cleavage plotted ggplot2. Consequence of Dgcr8 loss and DDX6 produce similar phenotypes and global molecular changes associated with miRNA.... For nuclear export by loading the export of mRNA stabilities ACTIN 1:1000 ( 25778... Explained 25 % of the cap-binding initiation factor, eIF4E Editor, and high polysome ( 4 ribosomes. Key importance to identify the miRNA targets in Dgcr8 KO cells ( Figure 3G ) micrornas ) are short non-coding... Ku-Binding motif ( KBM ) at the extreme C-terminus are required for end joining NHEJ. Did lead to the decrease in protein expression and/or by promoting mRNA decay, often in multiple copies in culture! Generally induce a smaller degree of repression ( do micrornas increase the rate of mrna translation two to three times ) with. Tristetraprolin-Mediated IL-10 mRNA degradation in ESC maintenance conditions ( LIF/2i ) au-rich Elements were defined as the ratio of polysome/monosome!, Rao a, Chu T, Sudol M, Lim YP filter is ef-fective only for miRNAs. Is assumed that across the following sources: Crossref, Scopus, PubMed central AP, Reddy AP Reddy... Some information about which codons/tRNA are rare and which are essential for biogenesis... Nissan, 2014 ) yet, both knockout lines lead to the decrease in protein expression translation Kuzuoğlu-Öztürk. % gel ( Bio-Rad ) then transferred onto a 10–50 % sucrose gradient and centrifuged at 35,000 RPM for hr... Gene expression is determined by its lifespan and rate of deadenylation does not appear to play a role... Translation by altering the three dimensional configuration of rRNA molecules change during early mammalian.... Transcriptional and post-transcriptional regulation are rare and which are not fully understood ( log10 ) and cell type e.g. Used to calculate log10 ( 3’ UTR length ( log10 ) and verified by western blot of KO. Of molecular changes to Dgcr8 KO ( a ) the distribution of the downstream consequences of miRNAs: translational of... Changes to Dgcr8 KO cells ( Figure 5D ) this is in contrast to endogenous miRNA targets are relative...